bims-polyam 2019-05-26 papers

on Polyamines

Issue of 2019–05–26
twelve papers selected by
Sebastian J. Hofer, University of Graz and Alexander Ivanov, Engelhardt Institute of Molecular Biology

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.
Spermine-NBD as fluorescent probe for studies of the polyamine transport system in Leishmania donovani.
Involvement of polyamines in sucrose-induced tolerance to atrazine-mediated chemical stress in Arabidopsis thaliana.
Complexity and Conservation of Thermospermine-Responsive uORFs of SAC51 Family Genes in Angiosperms.
Urea cycle disorders-update.
Neptunomonas marina sp. nov., isolated from seawater.
Proposal of Pedobacter nototheniae sp. nov., isolated from the spleen of a black rock cod (Notothenia coriiceps, Richardson 1844) from the Chilean Antarctica.
Analysis of Arginine Metabolism Using LC-MS and Isotopic Labeling.
Flavobacterium amnicola sp. nov., isolated from a sub-tropical stream.
Stable Isotope Tracers for Metabolic Pathway Analysis.
Sphingomonas crocodyli sp. nov., isolated from a crocodile pond.
Integrative transcriptomics, proteomics, and metabolomics data analysis exploring the injury mechanism of ricin on human lung epithelial cells.

Nucleic Acids Res. 2019 May 22. pii: gkz434. [Epub ahead of print]

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.

Sergiy Perepelytsya, Jozef Uličný, Aatto Laaksonen, Francesca Mocci.

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

DOI: https://doi.org/10.1093/nar/gkz434
Bioorg Med Chem Lett. 2019 May 17. pii: S0960-894X(19)30327-0. [Epub ahead of print]

Spermine-NBD as fluorescent probe for studies of the polyamine transport system in Leishmania donovani.

Elodie Jagu, Sébastien Pomel, Stéphanie Pethe, Jean-Christophe Cintrat, Philippe M Loiseau, Raphaël Labruère.

  This study describes the synthesis of fluorescent probes as potential substrates for the polyamine transport system (PTS) of Leishmania donovani. A competitive radioassay was used to determine the most efficient probe. We observed that the conjugate spermine-nitrobenzofurazan (Spm-NBD) was able to compete with [3H]-spermidine in L. donovani at a potent IC50 of 60 µM.

Keywords:  Fluorescence; Leishmania donovani; Polyamine transport; Radioisotopic method

DOI:  https://doi.org/10.1016/j.bmcl.2019.05.030
J Plant Physiol. 2019 May 01. pii: S0176-1617(19)30057-4. [Epub ahead of print]238 1-11

Involvement of polyamines in sucrose-induced tolerance to atrazine-mediated chemical stress in Arabidopsis thaliana.

Abdelhak El Amrani, Ivan Couée, Richard Berthomé, Fanny Ramel, Gwenola Gouesbet, Cécile Sulmon.

  Treatment of Arabidopsis thaliana seedlings with the PSII-inhibiting herbicide atrazine results in xenobiotic and oxidative stress, developmental arrest, induction of senescence and cell death processes. In contrast, exogenous sucrose supply confers a high level of atrazine stress tolerance, in relation with genome-wide modifications of transcript levels and regulation of genes involved in detoxification, defense and repair. However, the regulation mechanisms related to exogenous sucrose, involved in this sucrose-induced tolerance, are largely unknown. Characterization of these mechanisms was carried out through a combination of transcriptomic, metabolic, functional and mutant analysis under different conditions of atrazine exposure. Exogenous sucrose was found to differentially regulate genes involved in polyamine synthesis. ARGININE DECARBOXYLASE ADC1 and ADC2 paralogues, which encode the rate-limiting enzyme (EC 4.1.1.19) of the first step of polyamine biosynthesis, were strongly upregulated by sucrose treatment in the presence of atrazine. Such regulation occurred concomitantly with significant changes of major polyamines (putrescine, spermidine, spermine). Physiological characterization of a mutant affected in ADC activity and exogenous treatments with sucrose, putrescine, spermidine and spermine further showed that modification of polyamine synthesis and of polyamine levels could play adaptive roles in response to atrazine stress, and that putrescine and spermine had antagonistic effects, especially in the presence of sucrose. This interplay between sucrose, putrescine and spermine is discussed in relation with survival and anti-death mechanisms in the context of chemical stress exposure.

Keywords:  Atrazine herbicide; Chemical stress; Molecular regulations; Polyamine dynamics; Sucrose-induced tolerance

DOI:  https://doi.org/10.1016/j.jplph.2019.04.012
Front Plant Sci. 2019 ;10 564

Complexity and Conservation of Thermospermine-Responsive uORFs of SAC51 Family Genes in Angiosperms.

Soichi Ishitsuka, Mai Yamamoto, Minaho Miyamoto, Yoshitaka Kuwashiro, Akihiro Imai, Hiroyasu Motose, Taku Takahashi.

  ACAULIS5 (ACL5) encodes thermospermine synthase in Arabidopsis and its loss-of-function mutant acl5 shows excess xylem differentiation and severe dwarfism. SAC51 encodes a basic helix-loop-helix (bHLH) protein and was identified from sac51-d, a dominant suppressor mutant of acl5, which restores the wild-type phenotype without thermospermine. The 5' leader of the SAC51 mRNA contains multiple upstream open-reading frames (uORFs) and sac51-d has a premature stop codon in the fourth uORF. This uORF is conserved among SAC51 family genes in vascular plants. According to the GUS reporter assay, the SAC51 promoter was not responsive to thermospermine but the SAC51 5' leader fused to the constitutive 35S promoter enhanced the GUS activity in response to thermospermine. Disruption experiments of each start codon of the SAC51 uORFs revealed that uORF4 and uORF6 whose start codon corresponds to the second methionine codon of uORF4 had an inhibitory effect on the main ORF translation while the other four uORFs rather had a stimulatory effect. The response of the 5' leader to thermospermine was retained after disruption of each one of six start codons of these uORFs but abolished by mutating both uORF4 and uORF6 start codons, suggesting the importance of the C-terminal sequence shared by these uORFs in the action of thermospermine. We introduced GUS fusions with 5' leaders of SAC51 family genes from other angiosperm species into Arabidopsis and found that all 5' leaders responsive to thermospermine, so far examined, contained these two conserved, and overlapping uORFs.

Keywords:  ACL5; Arabidopsis thaliana; SAC51; thermospermine; translational regulation; uORF

DOI:  https://doi.org/10.3389/fpls.2019.00564
J Hum Genet. 2019 May 20.

Urea cycle disorders-update.

Shirou Matsumoto, Johannes Häberle, Jun Kido, Hiroshi Mitsubuchi, Fumio Endo, Kimitoshi Nakamura.

The urea cycle is a metabolic pathway for the disposal of excess nitrogen, which arises primarily as ammonia. Nitrogen is essential for growth and life-maintenance, but excessive ammonia leads to life-threatening conditions. The urea cycle disorders (UCDs) comprise diseases presenting with hyperammonemia that arise in either the neonatal period (about 50% of cases) or later. Congenital defects of the enzymes or transporters of the urea cycle cause the disease. This cycle utilizes five enzymes, two of which, carbamoylphosphate synthetase 1 and ornithine transcarbamylase are present in the mitochondrial matrix, whereas the others (argininosuccinate synthetase, argininosuccinate lyase and arginase 1) are present in the cytoplasm. In addition, N-acetylglutamate synthase and at least two transporter proteins are essential to urea cycle function. Severity and age of onset depend on residual enzyme or transporter function and are related to the respective gene mutations. The strategy for therapy is to prevent the irreversible toxicity of high-ammonia exposure to the brain. The pathogenesis and natural course are poorly understood because of the rarity of the disease, so an international registry system and novel clinical trials are much needed. We review here the current concepts of the pathogenesis, diagnostics, including genetics and treatment of UCDs.

DOI: https://doi.org/10.1038/s10038-019-0614-4
Arch Microbiol. 2019 May 21.

Neptunomonas marina sp. nov., isolated from seawater.

Wen-Ming Chen, Tsai-Ying Hsieh, Shih-Yi Sheu.

  Strain HPM-16T, isolated from seawater, was characterized using a polyphasic taxonomy approach. Phylogenetic analyses based on 16S rRNA gene sequences and coding sequences of an up-to-date bacterial core gene set (92 protein clusters) indicated that strain HPM-16T formed a phylogenetic lineage in the genus Neptunomonas. Strain HPM-16T was most closely related to Neptunomonas concharum LHW37T with 16S rRNA gene sequence similarity of 96.7%. Cells were Gram-stain negative, facultatively anaerobic, motile by means of a single polar flagellum, rod-shaped and formed white colonies. Optimal growth occurred at 30-35 °C, pH 6.5-8, and in the presence of 2-5% NaCl. C18:1ω7c and summed feature 3 (C16:1ω7c and/or C16:1ω6c) were the predominant fatty acids. The only isoprenoid quinone was Q-8. The polar lipid profile revealed the presence of phosphatidylethanolamine, phosphatidylglycerol and several uncharacterized lipids. The major polyamines were putrescine and spermidine. The draft genome was approximately 3.68 Mb in size with a G + C content of 50.5 mol%. Differential phenotypic properties, together with the phylogenetic inference, demonstrate that strain HPM-16T should be classified as a novel species of the genus Neptunomonas, for which the name Neptunomonas marina sp. nov. is presented. The type strain is HPM-16T (= BCRC 80980T = LMG 29560T = KCTC 52235T).

Keywords:  Gammaproteobacteria; Neptunomonas marina sp. nov.; Oceanospirillaceae; Oceanospirillales; Polyphasic taxonomy

DOI:  https://doi.org/10.1007/s00203-019-01671-7
Antonie Van Leeuwenhoek. 2019 May 22.

Proposal of Pedobacter nototheniae sp. nov., isolated from the spleen of a black rock cod (Notothenia coriiceps, Richardson 1844) from the Chilean Antarctica.

Peter Kämpfer, Rute Irgang, Guillermo Fernández-Negrete, Hans-Jürgen Busse, Matías Poblete-Morales, Derie Fuentes-Messina, Stefanie P Glaeser, Ruben Avendaño-Herrera.

  A pink pigmented, Gram-negative, rod-shaped, non-spore-forming bacterium (strain 36B243T), was isolated from the spleen of a black rock cod (Notothenia coriiceps, Richardson 1844) in the Chilean Antarctica. Strain 36B243T has a 5.26 Mb chromosome with a DNA G + C content of 35.4 mol%. The draft genome includes the prediction and annotation of 4585 coding genes, and 46 tRNA, 1 tmRNA, and 2735 hypothetical proteins. Phylogenetic analysis based on the 16S rRNA gene sequence placed strain 36B243T into the genus Pedobacter with high sequence similarity to the type strains of Pedobacter sandarakinus (97.5%) and Pedobacter petrophilus (97.1%). Sequence similarities to type strains of all other current Pedobacter species were below 97.1%. Predominant fatty acids are summed feature 3 (C16:1ω7c and/or C16:1ω6c) and iso-C15:0 followed by iso-C17:0 3-OH and C16:0. The major respiratory quinone was menaquinone MK-7. The polar lipid profile contained the major lipids phosphatidylethanolamine, five unidentified aminolipids, two lipids lacking a functional group and two minor glycolipids and one lipid lacking a functional group. An alkali-stable lipid was present. The polyamine pattern contained the predominant compound sym-homospermidine. Characterization by 16S rRNA gene sequence analysis, physiological parameters, pigment analysis, ubiquinone, polar lipid, and fatty acid composition revealed that strain 36B243T represents a new species of the genus Pedobacter. For this reason, we propose the name Pedobacter nototheniae sp. nov. with the type strain 36B243T (= LMG 30634T = CCM 8855T = CIP 111622T).

Keywords:  Antarctica; Black rock cod; Pedobacter; nototheniae

DOI:  https://doi.org/10.1007/s10482-019-01275-7
Methods Mol Biol. 2019 ;1978 199-217

Analysis of Arginine Metabolism Using LC-MS and Isotopic Labeling.

Gretchen L Seim, Emily C Britt, Jing Fan.

  Arginine metabolism is linked to several important metabolic processes, and reprogramming of arginine metabolism occurs in various physiological and pathological conditions. Here we describe a method, using a LC-MS-based metabolomics and 15N4-arginine tracing approach, to quantitatively analyze arginine metabolism. This method can reliably quantify the abundance of important intermediates and fluxes of major metabolic reactions in arginine metabolism in a variety of cultured mammalian cell models.

Keywords:  Arginine; Isotopic labeling; LC-MS; Metabolic flux analysis

DOI:  https://doi.org/10.1007/978-1-4939-9236-2_13
Int J Syst Evol Microbiol. 2019 May 23.

Flavobacterium amnicola sp. nov., isolated from a sub-tropical stream.

Shih-Yi Sheu, Ya-Ping Guo, Wen-Ming Chen.

Strain LLJ-11T, isolated from water sampled from a freshwater stream in Taiwan, was characterized using a polyphasic taxonomy approach. Cells of strain LLJ-11T were Gram-stain-negative, strictly aerobic, motile by gliding, rod-shaped and formed translucent yellow colonies. Optimal growth occurred at 25 °C, pH 7 and 0 % NaCl. Phylogenetic analyses based on 16S rRNA gene sequences and coding sequences of 92 protein clusters indicated that strain LLJ-11T is affiliated with species in the genus Flavobacterium. Strain LLJ-11T was most closely related to Flavobacterium amniphilum KYPY10T with 98.0 % 16S rRNA gene sequence identity. The DNA-DNA relatedness of strain LLJ-11T with respect to Flavobacterium species was less than 35 %. Average nucleotide identity and digital DNA-DNA hybridization values between strain LLJ-11T and the type strains of other closely related Flavobacterium species were 70.0-76.3 % and 21.1-23.9 %, respectively. Strain LLJ-11T contained iso-C15 : 0, iso-C15 : 1 G, iso-C17 : 0 3-OH, iso-C15 : 0 3-OH, summed feature 3 (C16 : 1ω6c and/or C16 : 1ω7c) and summed feature 9 (iso-C17 : 1ω9c and/or 10-methyl C16 : 0) as the predominant fatty acids. The major isoprenoid quinone was MK-6. The polar lipid profile consisted of phosphatidylethanolamine, three uncharacterized aminophospholipids and two uncharacterized phospholipids. The major polyamine was homospermidine. The DNA G+C content was 34.8 mol%. On the basis of the phylogenetic inference and phenotypic data, strain LLJ-11T is considered a representative of a novel species within the genus Flavobacterium. The name Flavobacterium amnicola sp. nov. is proposed, with strain LLJ-11T (=BCRC 81124T=LMG 30599T=KCTC 62514T) as the type strain.

DOI: https://doi.org/10.1099/ijsem.0.003463
Methods Mol Biol. 2019 ;1978 269-283

Stable Isotope Tracers for Metabolic Pathway Analysis.

Sara Violante, Mirela Berisa, Tiffany H Thomas, Justin R Cross.

  Stable isotope tracing allows a metabolic substrate to be followed through downstream biochemical reactions, thereby providing unparalleled insights into the metabolic wiring of cells. This approach stops short of modeling absolute fluxes but is relatively straightforward and has become increasingly accessible due to the widespread adoption of high-resolution mass spectrometers. Analysis of both dynamic and steady-state labeling patterns in downstream metabolites provides valuable qualitative information as to their origin and relative rates of production. Stable isotope tracing is, therefore, a powerful way to understand the impact of genetic alterations and defined perturbations on metabolism. In this chapter, we describe a liquid chromatography-mass spectrometry (LC-MS) protocol for stable isotope tracing using 13C-L-arginine in a macrophage cell line. A similar approach can be used to follow other stable isotope tracers, and notes are provided with advice on how this protocol can be generalized for use in other settings.

Keywords:  Fluxomics; Metabolomics; Stable isotope; Tracing experiments

DOI:  https://doi.org/10.1007/978-1-4939-9236-2_17
Int J Syst Evol Microbiol. 2019 May 23.

Sphingomonas crocodyli sp. nov., isolated from a crocodile pond.

Shih-Yi Sheu, Yi-Ru Xie, Soon-Wo Kwon, Ceshing Sheu, Wen-Ming Chen.

Strain CCP-7T, isolated from a freshwater pond in Taiwan, was characterized using a polyphasic taxonomy approach. Phylogenetic analyses based on 16S rRNA gene sequences and coding sequences of 92 protein clusters indicated that strain CCP-7T formed a phylogenetic lineage in the genus Sphingomonas. Strain CCP-7T was most closely related to Sphingomonas starnbergensis 382T and Sphingomonas naphthae DKC-5-1T with 96.2 % 16S rRNA gene sequence similarity. Strain CCP-7T showed 65.5-76.7 % average nucleotide identity and 20.2-22.5 % digital DNA-DNA hybridization identity with the strains of other related Sphingomonas species. Cells were Gram-stain-negative, aerobic, motile, rod-shaped and formed light orange-coloured colonies. Optimal growth occurred at 30 °C, pH 6 and in the absence of NaCl. The major fatty acid of strain CCP-7T was C18 : 1ω7c. The polar lipid profile consisted of phosphatidylethanolamine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylmonomethylethanolamine, three uncharacterized sphingoglycolipids, two uncharacterized phospholipids and six uncharacterized lipids. The predominant polyamine was homospermidine. The only isoprenoid quinone was Q-10. Genomic DNA G+C content of strain CCP-7T was 64.5 %. On the basis of phenotypic and genotypic properties and phylogenetic inference, strain CCP-7T should be classified in a novel species of the genus Sphingomonas, for which the name Sphingomonas crocodyli sp. nov. is proposed. The type strain is CCP-7T (=BCRC 81096T=LMG 30311T=KCTC 62190T).

DOI: https://doi.org/10.1099/ijsem.0.003455
Toxicol In Vitro. 2019 May 16. pii: S0887-2333(19)30077-3. [Epub ahead of print]

Integrative transcriptomics, proteomics, and metabolomics data analysis exploring the injury mechanism of ricin on human lung epithelial cells.

Na Xu, Mingxin Dong, Yan Wang, Ying Chang, Jiayu Wan, Wenhe Zhu, Jinglin Wang, Wensen Liu.

  Ricin (RT) is a plant toxin belonging to the family of type II ribosome-inactivating protein with high bioterrorism potential. Aerosol RT exposure is the most lethal route, but its mechanism of injury needs further investigation. In the present study, we performed a comprehensive transcriptomics, proteomics and metabolomics analysis on the potential mechanism of injury caused by RT on human lung epithelial cells. In total, 5872 genes, 187 proteins, and 143 metabolites were shown to be significantly changed in human lung epithelial cells after RT treatment. Molecular function, pathway, and network analyses, the genes and proteins regulated in RT-treated cells were mainly attributed to fatty acid metabolism, arginine and proline metabolism and ubiquitin-mediated proteolysis pathway. Furthermore, a comprehensive analysis of transcripts, proteins, and metabolites was performed. The results revealed the correlated genes, proteins, and metabolic pathways regulated in metabolic pathways, amino acid metabolism, transcription and energy metabolism. These genes, proteins, and metabolites involved in these dis-regulated pathways may provide a more targeted and credible direction to study the mechanism of RT injury on human lung epithelial cells. This study provides large-scale omics data that can be used to develop a new strategy for the prevention, rapid diagnosis, and treatment of RT poisoning, especially of RT aerosol.

Keywords:  Human lung epithelial cells; Metabolomics; Proteomics; Ricin; Transcriptomics

DOI:  https://doi.org/10.1016/j.tiv.2019.05.012